• Users Online: 156
  • Print this page
  • Email this page

 
Table of Contents
ORIGINAL ARTICLE
Year : 2021  |  Volume : 15  |  Issue : 1  |  Page : 29-33

Cytomegalovirus disease in post-renal transplant patients: An Indian experience - A prospective observational study


1 Department of Virology, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow, Uttar Pradesh, India
2 Department of Pathology, Government Medical College, Azamgarh, Uttar Pradesh, India
3 Department of Life Sciences, SARC, Meerut, Uttar Pradesh, India
4 Department of Nephrology, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow, Uttar Pradesh, India

Date of Submission13-Jul-2020
Date of Acceptance22-Nov-2020
Date of Web Publication31-Mar-2021

Correspondence Address:
Dr. Kamlesh Yadava
Department of Pathology, Government Medical College, Azamgarh, Uttar Pradesh
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijot.ijot_80_20

Get Permissions

  Abstract 


Background: Cytomegalovirus is an important viral pathogen causing infection in immunodeficient patient especially in solid organ transplant like renal transplant. This study aims to evaluate the prevalence and clinical impact of CMV infection in renal transplant patients in a tertiary care hospital in Northern India. Materials and Methods: 145 renal transplant patients were tested for cytomegalovirus DNA by polymerase chain reaction (PCR) and for presence of IgM and IgG antibody against cytomegalovirus by ELISA. PCR amplified product were detected by Agarose gel electrophoresis. Results: Out of 145 transplant patients CMV Viremia was detected by PCR in 16(11.0%) patients. Two patients died in the study period in which one patient had HBV and other had HCV infection. IgM antibody against CMV was detected in one out of 145 donors while IgG anti-CMV antibody was detected in all 145 donors and recipients by ELISA. Two out of 145 transplant recipients had positive CMV PCR in pre-transplant period, and both had positive CMV PCR in post-transplant period. Out of sixteen positive patients histopathology changes of CMV disease was found in 2 patients (12.5%). Conclusion: Cytomegalovirus disease is major cause of morbidity and mortality in renal transplant patients. PCR to detect specific CMV genome sequences is important tool for early diagnosis and specific anti viral therapy. In our study out of 145 transplant patients, CMV Viremia was detected by PCR in 16 patients (11.0%). Two patients in the study period died, in which one patient had HBV and other had HCV infection, remaining patients survived with varying range of serum creatinine levels. Diagnostic histological changes of CMV is seen only in minority of cases(12.5%) who are positive by PCR for CMV.

Keywords: Cytomegalovirus, polymerase chain reaction, renal, transplant


How to cite this article:
Yadav P, Yadava K, Tandon N, Prasad N, Dhole T N. Cytomegalovirus disease in post-renal transplant patients: An Indian experience - A prospective observational study. Indian J Transplant 2021;15:29-33

How to cite this URL:
Yadav P, Yadava K, Tandon N, Prasad N, Dhole T N. Cytomegalovirus disease in post-renal transplant patients: An Indian experience - A prospective observational study. Indian J Transplant [serial online] 2021 [cited 2021 Apr 11];15:29-33. Available from: https://www.ijtonline.in/text.asp?2021/15/1/29/312759




  Introduction Top


The most common clinical picture in the transplanted host is a viral syndrome, characterized by fever and malaise as well as leukopenia, thrombocytopenia, and elevated liver enzymes. These signs appear from the 3rd to 4th week, with a peak from the 6th to 16th week, and become rare after the 6th month. Upper digestive tract symptoms, mainly pain, are common. Respiratory symptoms indicate more severe disease and may require admission to an intensive care unit.

Cytomegalovirus (CMV) is a ubiquitous herpes virus that infects up to 60%−100% of people in adulthood and it is one of the main agents involved in infectious complications after transplantation. CMV, similar to other herpes viruses, establishes a latent infection after the initial infection. In the immunocompetent host, the initial infection is generally asymptomatic but may present as an unspecified febrile, flu-like, or mononucleosis-like syndrome. In rare cases, the infection presents as a systemic syndrome, affecting many organs. In addition, immunocompetent adults may present a clinical syndrome later in life due to reactivation of latent virus or due to new infection by another viral strain. The disease caused by posttransplant CMV (PT-CMV) occurs due to transmission from the transplanted organ due to reactivation of latent infection or after a primary infection in seronegative transplant patients 1–5.

Human CMV (HCMV) is a member of Herpesviridae, subfamily β-Herpesviridae. CMV is known for causing infection in immunocompromised hosts like solid organ transplant patients and in AIDS patients. CMV also causes congenital infection in 0.3%–2.5% live births.[1] CMV infection is an important cause of morbidity and mortality in immunosuppressed patients, particularly among allograft recipients, whose number has increased markedly in recent years. Numerous studies have shown that the majority of patients develop evidence of active CMV infection following kidney transplantation. Although most of these individuals have asymptomatic infections, others have clinical manifestations of illness (overt CMV disease) ranging from high fever to death. The rapid and specific diagnosis of active CMV infection in these patients is important since its manifestations may resemble those of transplant rejection but require distinct management.[2],[3],[4],[5],[6],[7] Several procedures for the detection of CMV are available, including conventional virus culture, shell vial, serology tests, antigenemia, and polymerase chain reaction (PCR).[8],[9],[10],[11],[12],[13] True prevalence study for CMV disease in posttransplant patients using real-time (RT-PCR) is lacking in northern India. Since CMV disease is an important cause of the morbidity and graft failure in transplant patients, this study is especially needed to highlight CMV-related disease and to prevent graft failure.


  Materials and Methods Top


Patients

It is a prospective observational study conducted between January 2015 and January 2017. A total number of 145 renal transplant patients coming to the Nephrology Departments of SGPGIMS, Lucknow, clinically suspected for CMV were selected for the present study. Informed consent was obtained from all patients and the protocol was approved by the Hospital's Ethics Committee wide IEC No 2016-66-PhD-EXP. P < 0.05 was considered statistically significant. All statistical analysis were performed using trial version of SPSS 16 software package.

Clinical specimens

We collected samples for CMV PCR in just pretransplant period and 2 months, 4 months as well as 6 months posttransplant period. The whole blood was stored using the glycigel method and frozen at −80°C until DNA extraction. Blood was collected in a centrifuge tube from pretransplant patients and plasma was separated from the blood. Plasma was used for viral DNA extraction. Plasma was stored at −80°C.

Serology

Serum CMV immunoglobulin M (IgG) and immunoglobulin M (IgM) antibodies were determined by ELISA.

Real-time polymerase chain reaction

DNA extraction

Nucleic acid was extracted from 0.2 ml of EDTA according to the standard method of extraction. DNA was eluted from columns in a final volume of 200 μl of elution and was stored at −20°C until used. These extracted DNA samples were used for qualitative PCR assays. DNA amplification was carried out using primers obtained from the region, as reported by Barber et al.[14] The primers used were upstream 5'AGACCTTCATGCAGATCT CC3' (2037–2057) 20 mer and downstream 5'GGTGCTCACGCACATTGATC3' (2280–2300) 20 mer.

Polymerase chain reaction

The PCR components use 5 μl of the nucleic acid extract, added in 45 μl of reaction mixture containing 1 μl (each) dNTP, 1 μl unit of Taq polymerase and 0.5 μl forward primer and 0.5 μl reverse primer. Temperature and time profiles is as following: Thermal cycling consists of an initial denaturation and the steps are as 94°C for 5 minutes, 94°C for 20 seconds and 60°C for 30 seconds , 72°C for 30 seconds for 30 cycles and a final incubation at 72°C for 5 minutes. PCRs were visualized by agarose gel electrophoresis and sequenced directly. PCR products were loaded on 2% agarose gel containing ethidium bromide (0.01 mg/μl) [Figure 1].
Figure 1: Representative gel image of cytomegalovirus polymerase chain reaction

Click here to view


Criteria of cytomegalovirus infection

Patients were clinically suspected of having CMV disease based on the standard criteria described.[15] Diagnostic criteria for CMV disease were based on a recommendation made by the workshop on HCMV disease.[16] Active CMV disease was defined if clinically suspected patients showed: (1) one or more positive results of HCMV DNA by PCR in blood or urine and (2) CMV antibody seroconversion in a patient who was seronegative before transplant. Workup for microorganisms other than CMV included multiple bacteriological cultures, serology for hepatitis virus, and chest radiographs.

Statistical analysis

Data were analysed with the help of Microsoft excel 2007 and SPSS version 16thsoftware. Appropriate tables were generated given in χ2 (Chi-square) test applied for inference. A P value of <0.05 was considered statistically significant. All statistical analysis was performed using trial version SPSS 16 software package.

Patient consent

The patient consent has been taken for participation in the study and for publication of clinical details and images. Patients understand that the names, initials would not be published, and all standard protocols will be followed to conceal their identity.

Ethics statement

The study was approved by Institutional Ethics Committee, SGPGIMS, Lucknow, UP, India vide IEC No 201666PhDEXP. All protocols were followed as per Declaration of Helsinki.


  Results Top


The basic information of the patient is presented in [Table 1]. The participants in the study were of minimum 16 years and maximum age 61 years. Moreover, maximum number of patients belonged to male gender.
Table 1: Distribution of the patients according to their demographic characteristics

Click here to view


The below [Table 1] shows age-wise and gender-wise distribution of the patients. Maximum number of patients were in the age group of <30 years. Gender-wise distribution also shows that maximum number of patients were from the male gender.

In this study, pretransplant PCR was positive in two cases, of which one was male and one was female. However, in postPCR test, males were more positive than females. However, the above test was not statically significant as P > 0.05 [Table 2].
Table 2: Distribution of patients gender-wise pretransplant polymerase chain reaction and posttransplant polymerase chain reaction

Click here to view


[Table 3] shows that most of the positive cases in pre- as well as posttransplant cases were in the younger age group (<40 years), although correlation is not statistically significant.
Table 3: Distribution of patients age-wise pretransplant polymerase chain reaction and posttransplant polymerase chain reaction

Click here to view


Out of 145 transplant patients enrolled in the study, CMV viremia was detected by PCR in 16 patients (11.0%) who were having clinical manifestation of CMV disease. CMV positivity was seen in 2 months (08 weeks) to 4 months (16 weeks) posttransplant period with a mean of 12 weeks. Out of 16 positive patients, 12 were male and 4 were female with a male-to-female ratio of 3:1. The mean age of positive patients was 39 ± 12.9 years with a range of 23–69 years. CMV positivity was more in younger patients who were commonly in the age range of 23–35 years [Figure 2]. Out of sixteen patients, four patients had mixed viral infections including hepatitis C in one and other three had hepatitis B. No patient had active pulmonary tuberculosis despite clinical evidence of pneumonia in patients. Out of sixteen positive patients, histopathology changes of CMV disease were found in 2 patients (12.5% of positive cases). Two patients in the study died in the study period, in which one patient had hepatitis B virus (HBV) and other had hepatitis C virus (HCV) infection. Death of these two patients could not be attributed to CMV disease only, as they had other comorbidity. The remaining patients survived with varying ranges of serum creatinine.
Figure 2: Distribution of patient age-wise

Click here to view


One out of 145 donors has IgM CMV ELISA–positive, while IgG CMV ELISA was reactive in all 145 donors. CMV PCR was negative in the recipient of IgM-positive donor in posttransplant period, suggesting the absence of CMV disease in posttransplant period. Two out of 145 transplant recipients had positive CMV PCR in pretransplant period and both had positive CMV PCR in posttransplant period. One of such patient became negative on PCR after successful anti-CMV therapy.


  Discussion Top


CMV is an important cause of morbidity and mortality to some extent in immunocompromised patients and is serious problem in organ transplant patients. Since there is specific antiviral therapy against CMV infection, timely diagnosis and treatment will prevent most of the morbidity and mortality caused by CMV disease.[17],[18] Since cell assay is time consuming and tedious, many previous studies have demonstrated the use of PCR to amplify specific CMV genome sequences and its use in the diagnosis of CMV disease and monitoring antiviral therapy against CMV.[19]

To our knowledge, this is one of few Indian studies conducted in tertiary care referral center in northern India to use PCR for the detection of CMV infection and disease in renal transplant patients. With this technique, we identified viral DNA in 11.0% of transplant patients who were clinically suspected of having CMV disease. Findings of Chen et al.[17] and others suggest that PCR is capable of detecting CMV DNA only in patients with an active infection and not in seropositive healthy individuals as well as seropositive transplant patients without clinical evidence of active CMV infection. Our results show a slightly less prevalence of CMV disease in posttransplant patients as reported by John who has reported ~20% prevalence of CMV disease in renal transplant patients from southern India[20] and much lower prevalence as reported by Costa et al. from Brazil.[21]

Predominant clinical feature detected in patients with evidence of active CMV disease was fever. Other clinical manifestations included raised blood pressure and abnormal serum creatinine which may be due to ongoing rejection and partly may be due to CMV disease. Two patients showed pneumonia in the absence of tuberculosis. One patient had coexistent hepatitis C and three had hepatitis B, while hepatitis with variable raised liver enzymes was found in other patients who were not infected with hepatitis viruses. Out of sixteen positive cases, two cases (12.5%) showed histological evidence of CMV disease on biopsy in the form of nucleomegaly, while majority did not show histological changes of viral cytopathy. Histological changes of viral cytopathy may be in cases of high viral load. Quantitative viral load will best tell the story of the correlation of CMV disease with histological changes diagnostic of CMV infection.

Only one out of 145 donors had IgM CMV ELISA positive and IgG CMV ELISA was positive in all 145 donors. CMV PCR was negative after transplant in case of IgM CMV ELISA-positive donors suggesting the absence of CMV disease. Although statistically significant was not observed, this study suggests that PT-CMV disease is either due to reactivation of latent CMV virus in recipients or due to reinfection in the recipient of organ transplant. This observation is not in agreement with the observation of Hughes et al.[22] who concluded high CMV antigenemia in case of seropositive donors.

Limitations of the study

This study has some limitations. One of major limitation is short-term follow-up period. Long posttransplant follow-up is needed to see the effect of CMV disease on graft survival. Quantitative PCR and viral load is needed to see the correlation between viremia and histological changes.


  Conclusion Top


CMV disease is a major cause of morbidity and mortality in renal transplant patients. PCR to detect specific CMV genome sequences is an important tool for early diagnosis and specific antiviral therapy In our study out of 145 transplant patients, CMV viremia was detected by PCR in 16 patients (11.0%). Of two patients in the study period, one patient had HBV and other had HCV infection, the remaining patients survived with varying ranges of serum creatinine levels. Diagnostic histological changes of CMV were seen only in a minority of cases (12.5%) who were positive by PCR for CMV which may be the case of high viremia.

Acknowledgment

The authors acknowledged technical staffs of Virology and Nephrology Department, Sanjay Gandhi Post Graduate Institute of Medical Sciences Lucknow, India, for their selfless support in this work.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Demmler GJ, Kaplan SL, editors. Texbook of Pediatric Infectious Diseases. 5th ed.. Philadelphia, PA: Saunders; 2004. p. 1912-32.  Back to cited text no. 1
    
2.
Abecassis MM, Koffron AJ, Kaplan B, Buckingham M, Muldoon JP, Cribbins AJ, et al. The role of PCR in the diagnosis and management of CMV in solid organrecipients: What is the predictive value for the development of disease and should PCR be used to guide antiviraltherapy. Transplantation 1997;63:275-9.  Back to cited text no. 2
    
3.
Rubin RH. Impact of cytomegalovirus infection on organ transplant recipients. Rev Infect Dis 1990;12 Suppl 7:754-66.  Back to cited text no. 3
    
4.
Rubin RH, Levin M, Cohen C. Summary of a workshop on cytomegalovirus infections during organ transplantation. J Infect Dis 1979;139:728-34.  Back to cited text no. 4
    
5.
Rubin RH, Cosimi AB, Tolkoff-Rubin NE, Russell PS, Hirsch MS. Infection renal transplant recipients. Transplantation 1977;24:458-64.  Back to cited text no. 5
    
6.
Rubin RH, Tolkoff-Rubin NE, Oliver D, Rota TR, Hamilton J, Betts RF, et al. Multicenterseroepidemiologic study of the impact of cytomegalovirus infection on renal transplantation. Transplantation 1985;40:243-9.  Back to cited text no. 6
    
7.
Sweny P. Infection in solid organ transplantation. Curr Opin Infect Dis 1993;6:412-6.  Back to cited text no. 7
    
8.
Chou S. Newer methods for diagnosis of cytomegalovirus infection. Rev Infect Dis 1990;12 Suppl 7:727-36.  Back to cited text no. 8
    
9.
Costa SC, Miranda SR, Alves G, Rossi CL, Figueiredo LT, Costa FF. Donated organs as a source of cytomegalovirus (CMV) in renal transplant patients. Braz J Med Biol Res 1994;27:2573-8.  Back to cited text no. 9
    
10.
Drew WL. Diagnosis of cytomegalovirus infection. Rev Infect Dis 1988;10 Suppl 3:468-76.  Back to cited text no. 10
    
11.
Gleaves CA, Smith TF, Shuster EA, Pearson GR. Comparison of standard tube and shell vial cell culture techniques for the detection of cytomegalovirus in clinical specimens. J Clin Microbiol 1985;21:217-21.  Back to cited text no. 11
    
12.
Shibata D, Martin WJ, Appleman MD, Causey DM, Leedom JM, Arnheim N. Detection of cytomegalovirus DNA in peripheral blood of patients infected with human immunodeficiency virus. J Infect Dis 1988;158:1185-92.  Back to cited text no. 12
    
13.
Shuster EA, Beneke JS, Tegtmeier GE, Pearson GR, Gleaves CA, Wold AD, et al. Monoclonal antibody for rapid laboratory detection of cytomegalovirus infections: Characterization and diagnostic application. Mayo Clin Proc 1985;60:577-85.  Back to cited text no. 13
    
14.
Barber L, Egan JJ, Turner AJ, Guiver M, Woodcock AA, Yonan N, et al. The development of a quantitative PCR ELISA to determine HCMV DNAaemia level in hearhear/lung and lung transplant recepients. J Virol Methods 1999;82:85-97.  Back to cited text no. 14
    
15.
Chatterjee SN, Jordan GW. Prospective study of the prevalence and symptomatology of cytomegalovirus infection in renal transplant recipients. Transplantation 1979;28:457-60.  Back to cited text no. 15
    
16.
Ljungman P, Plotkin SA. Workshop on CMV disease, definitions, clinical severity scores and new syndromes. Scand J Infect Dis 1995;99 Suppl: 87-9.  Back to cited text no. 16
    
17.
Chen YT, Mercer GO, Cheigh JS, Mouradian JA. Cytomegalovirus infection of renal allografts. Transplantation 1992;53:99-102.  Back to cited text no. 17
    
18.
Griffiths PD, Whitley RJ. Viral infections in the immunocompromised host. Curr Opinion Infect Dis 1993;6:417-21.  Back to cited text no. 18
    
19.
Rowley AH, Wolinsky SM, Sambol SP, Barkholt AE, Anderson JP. Rapid detection of cytomegalovirus DNA and RNA in blood of renal transplant patients by in vitro enzymatic amplification. Transplantation 1991;51:1028-33.  Back to cited text no. 19
    
20.
John GT. Infections after renal transplant in India. J Nephrol Renal Transplant 2009;2:71-88.  Back to cited text no. 20
    
21.
Costa SC, Miranda SR, Alves G, Rossi CL, Figueiredo LT, Costa FF. Detection of cytomegalovirus infections by PCR in renal transplant patients. Braz J Med Biol Res 1999;32:953-9.  Back to cited text no. 21
    
22.
Hughes D, Hafferty J, Fulton L, Friend P, Devancy A, Loke J, et al. Donor and recipient CMV serostatus and antigenemia after renal transplantation: An analysis of 486 patients. J Clin Virol 2008;41:92-5.  Back to cited text no. 22
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed90    
    Printed0    
    Emailed0    
    PDF Downloaded12    
    Comments [Add]    

Recommend this journal